Premarital Genetic Diagnosis Revealed Co-heredity Nature of Beta Globin Gene 25-26 del AA and 3’UTR+101 G-C Variants in Two Beta Thalassemia Heterozygotes

Over 2000 gene variants were reported in the beta globin gene, including hemoglobin variants. These variants are important from clinical and genetic counseling points of view [1,2]. Recently a genetically related Turkish couple was referred to our department for genetic counseling for beta thalassemia carrier status. During premarital screening they were both diagnosed as beta thalassemia carriers by high pressure liquid chromatography analysis and whole blood count (Table 1). Genomic DNAs of both patients were extracted using the QIAamp DNA Blood Midi Kit (QIAGEN, Germany). The HBB gene was amplified using the following polymerase chain reaction (PCR) primers: forward (5’GCCAAGGACAGGTACGGCTG3’), reverse (5’CCCTTCCTATGACATGAACTTAACCAT3’) and forward (5’CAATGTATCATGCCTCTTTGCACC3’), reverse (5’GAGTCAAGGCTGAGGATGCGGA3’). Purifications were done using the ExoSAP purification program (Affymetrix Inc., USA). The BigDye Sequencing PCR technique was used for the analysis (Applied Biosystems, USA). Samples were analyzed with the SeqScape v2.5 analysis program. Common alpha globin gene deletions were analyzed according to the previously reported technique [3,4]. Two different gene alterations were found in the beta globin gene of both partners (Table 1). One of them was a deletion at 25-26AA (rs35497102) (Figure 1). The other gene alteration was a single nucleotide polymorphism at 3’UTR+101 G-C +233 relative to the termination codon (rs12788013) (Figure 2). Neither of the individuals carried the common alpha thalassemia deletions.